[Seqinr-forum] seqinr-forum-getOrganisms

[Jean lobry]

>  Dear all,
>
>  By using seqinr, I would like to create a fasta file from a list of 
>accession number.
>  So far, I do not have any problem to create the list, get the name (getName)
>  and the sequence (getSequence). I was just wondering if it would be 
>possible via seqinr
>  to get the organisms/taxonomy attibutes (on genbank database) in 
>order to have a fasta
>  file as below :
>
>  >Accesion_number_organisms_taxonomy
>  TGCAGCGCCGTCGGGTAAGACCAACTCCCATGGT
>
>  Thanks in advance
>
>  cheers
>  David

Dear David,

what is the source of your sequences? Could you give an example of the code
you are using?

Best,

-- 
Jean R. Lobry            (lobry at biomserv.univ-lyon1.fr)
Laboratoire BBE-CNRS-UMR-5558, Univ. C. Bernard - LYON I,
43 Bd 11/11/1918, F-69622 VILLEURBANNE CEDEX, FRANCE
allo  : +33 472 43 27 56     fax    : +33 472 43 13 88
http://pbil.univ-lyon1.fr/members/lobry/