[Seqinr-forum] seqinr-forum-getOrganisms

[David Lejon]

Dear all,

By using seqinr, I would like to create a fasta file from a list of 
accession number.
So far, I do not have any problem to create the list, get the name (getName)
and the sequence (getSequence). I was just wondering if it would be 
possible via seqinr
to get the organisms/taxonomy attibutes (on genbank database) in order 
to have a fasta
file as below :

 >Accesion_number_organisms_taxonomy
TGCAGCGCCGTCGGGTAAGACCAACTCCCATGGT

Thanks in advance

cheers
David
-------------- next part --------------
An HTML attachment was scrubbed...
URL: http://lists.r-forge.r-project.org/pipermail/seqinr-forum/attachments/20090624/f436196f/attachment.htm