<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
<html>
<head>
</head>
<body bgcolor="#ffffff" text="#000000">
<font size="2">Dear all,<br>
<br>
By using seqinr, I would like to create a fasta file from a list of
accession number.<br>
So far, I do not have any problem to create the list, get the name
(getName)<br>
and the sequence (getSequence). I was just wondering if it would be
possible via seqinr<br>
to get the organisms/taxonomy attibutes (on genbank database) in order
to have a fasta<br>
file as below :<br>
<br>
>Accesion_number_organisms_taxonomy<br>
TGCAGCGCCGTCGGGTAAGACCAACTCCCATGGT<br>
<br>
Thanks in advance<br>
<br>
cheers<br>
David<br>
</font>
</body>
</html>