[Seqinr-commits] r2152 - pkg/man
noreply at r-forge.r-project.org
noreply at r-forge.r-project.org
Mon Nov 28 15:42:34 CET 2022
Author: simonpenel
Date: 2022-11-28 15:42:34 +0100 (Mon, 28 Nov 2022)
New Revision: 2152
Modified:
pkg/man/GC.Rd
pkg/man/autosocket.Rd
pkg/man/cai.Rd
pkg/man/caitab.Rd
pkg/man/choosebank.Rd
pkg/man/countfreelists.Rd
pkg/man/countsubseqs.Rd
pkg/man/getliststate.Rd
pkg/man/gfrag.Rd
pkg/man/ghelp.Rd
pkg/man/isenum.Rd
pkg/man/kaks.Rd
pkg/man/knowndbs.Rd
pkg/man/modifylist.Rd
pkg/man/pK.Rd
pkg/man/plot.SeqAcnucWeb.Rd
pkg/man/prettyseq.Rd
pkg/man/query.Rd
pkg/man/read.fasta.Rd
pkg/man/readfirstrec.Rd
pkg/man/readsmj.Rd
pkg/man/residuecount.Rd
pkg/man/savelist.Rd
pkg/man/setlistname.Rd
Log:
Updating urls
Modified: pkg/man/GC.Rd
===================================================================
--- pkg/man/GC.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/GC.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -85,7 +85,7 @@
\code{citation("seqinr")}.
The program codonW used here for comparison is available at
- \url{http://codonw.sourceforge.net/}.
+ \url{https://codonw.sourceforge.net/}.
}
\seealso{You can use \code{\link{s2c}} to convert a string into a vetor of single
character and \code{\link{tolower}} to convert upper-case characters into
Modified: pkg/man/autosocket.Rd
===================================================================
--- pkg/man/autosocket.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/autosocket.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -12,7 +12,7 @@
\value{
An object of class sockconn.
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
Modified: pkg/man/cai.Rd
===================================================================
--- pkg/man/cai.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/cai.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -48,14 +48,14 @@
Are codon usage patterns in unicellular organisms determined by
selection-mutation balance.
\emph{Journal of Evolutionary Biology}, \bold{1}:15-26.
-
+
Peden, J.F. (1999)
Analysis of codon usage.
PhD Thesis, University of Nottingham, UK.
-
- The program \code{codonW} used here for comparison is available at
- \url{http://codonw.sourceforge.net/} under a GPL licence.
+ The program \code{codonW} used here for comparison is available at
+ \url{https://codonw.sourceforge.net/} under a GPL licence.
+
\code{citation("seqinr")}.
}
Modified: pkg/man/caitab.Rd
===================================================================
--- pkg/man/caitab.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/caitab.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -12,7 +12,7 @@
\describe{
\item{ec}{\emph{Escherichia coli}}
\item{bs}{\emph{Bacillus subtilis}}
- \item{sc}{\emph{Saccharomyces cerevisiae}}
+ \item{sc}{\emph{Saccharomyces cerevisiae}}
}
}
\details{
@@ -19,10 +19,10 @@
Codons are given by \code{row.names(caitab)}.
}
\source{
-The data were hard-encoded in
+The data were hard-encoded in
the C program codonW version 1.4.4 writen by John Peden
-available at \url{http://codonw.sourceforge.net/}. The data
-are from the file \code{codonW.h}.
+available at \url{https://codonw.sourceforge.net/}. The data
+are from the file \code{codonW.h}.
According to this source file, there were no reference for
\emph{Escherichia coli} and \emph{Bacillus subtilis} and the
reference for \emph{Saccharomyces cerevisiae} was Sharp
@@ -51,11 +51,11 @@
\emph{Nucleic Acids Research}, \bold{15}:1281-1295.
Shields, D.C., Sharp, P.M. (1987) Synonymous codon usage in \emph{Bacillus subtilis}
- reflects both traditional selection and mutational biases.
+ reflects both traditional selection and mutational biases.
\emph{Nucleic Acids Research}, \bold{15}:8023-8040.
- Sharp, P. M., Cowe, E. (1991).
- Synonymous codon usage in \emph{Saccharomyces cerevisiae}.
+ Sharp, P. M., Cowe, E. (1991).
+ Synonymous codon usage in \emph{Saccharomyces cerevisiae}.
\emph{Yeast}, \bold{7}:657-678.
Peden, J.F. (1999)
Modified: pkg/man/choosebank.Rd
===================================================================
--- pkg/man/choosebank.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/choosebank.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -2,12 +2,12 @@
\alias{choosebank}
\title{To select a database structured under ACNUC and located on the web}
\description{
- This function allows to select one of the databases structured under ACNUC and located on the web.
+ This function allows to select one of the databases structured under ACNUC and located on the web.
Called without arguments, \code{choosebank()}, will return the list of available databases.
- Then, you can use \code{\link{query}} to make your query and get a list of sequence names.
- Remote access to ACNUC databases works by opening a socket connection on a port (for example
- on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol
- described in the section \code{references}.
+ Then, you can use \code{\link{query}} to make your query and get a list of sequence names.
+ Remote access to ACNUC databases works by opening a socket connection on a port (for example
+ on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol
+ described in the section \code{references}.
}
\usage{
choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
@@ -24,7 +24,7 @@
\item{encoding}{string. The name of the encoding to be used. (see \code{\link{socketConnection}})}
\item{verbose}{logical. If TRUE, verbose mode is on}
\item{timeout}{integer. The timeout in seconds for \code{socketConnection}. Default 5 seconds.}
- \item{infobank}{logical. If \code{infobank} is TRUE and \code{bank} is \code{NA}, a data.frame
+ \item{infobank}{logical. If \code{infobank} is TRUE and \code{bank} is \code{NA}, a data.frame
with all database informations will be returned}
\item{tagbank}{string. If \code{bank} is \code{NA} and \code{tagbank} is documented, the names
of special purposes databases are returned. Current allowed values are TP
@@ -33,7 +33,7 @@
TEST for test databases, and DEV for databases under development (unstable).}
}
\details{
- When called without arguments, \code{choosebank()} returns a list of all the databases names known
+ When called without arguments, \code{choosebank()} returns a list of all the databases names known
by the server, as a vector of string. When called with \code{choosebank(infobank = TRUE)}, a data.frame
with more information is returned.
}
@@ -45,10 +45,10 @@
\item{banktype}{ the type of the bank (GENBANK, EMBL, SWISSPROT, NBRF)}
\item{totseqs}{ the total number of sequences present in the opened database }
\item{totspecs}{ the total number of species present in the opened database }
- \item{totkeys}{ the total number of keywords present in the opened database }
-
+ \item{totkeys}{ the total number of keywords present in the opened database }
+
When called with bank = NA:
-
+
\item{names}{ A vector of all available bank names.}
When called with bank = NA and infobank = TRUE, a data.frame with three columns:
@@ -55,15 +55,15 @@
\item{bank}{ The name of the bank. }
\item{status}{ The bank status (on/of). }
- \item{info}{ Short description of bank with last release date. }
+ \item{info}{ Short description of bank with last release date. }
}
-\references{
-For more information about the socket communication protocol with ACNUC please get at \url{http://doua.prabi.fr/databases/acnuc/remote_acnuc.html}.
-To get the release date and content of all the databases located at the pbil, please look at the following url: \url{http://doua.prabi.fr/search/releases}\cr
-Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system.
+\references{
+For more information about the socket communication protocol with ACNUC please get at \url{https://doua.prabi.fr/databases/acnuc/remote_acnuc.html}.
+To get the release date and content of all the databases located at the pbil, please look at the following url: \url{https://doua.prabi.fr/search/releases}\cr
+Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system.
\emph{Nucl. Acids Res.}, \bold{12}:121-127.\cr
-Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985)
+Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985)
ACNUC - a portable retrieval system for nucleic acid sequence databases:
logical and physical designs and usage.
\emph{Comput. Appl. Biosci.}, \bold{3}:167-172.\cr
@@ -74,7 +74,7 @@
}
\note{
The invisible list returned when a database is opened is stored in the variable
-\code{banknameSocket} in the global environment.
+\code{banknameSocket} in the global environment.
}
\author{D. Charif, J.R. Lobry}
\seealso{\code{\link{where.is.this.acc}} if you have a sequence accession number but you
@@ -82,12 +82,12 @@
is opened, \code{\link{connection}}, \code{\link{socketConnection}} }
\examples{
\dontrun{# Need internet connection
- # Show available databases:
+ # Show available databases:
choosebank()
# Show frozen databases:
choosebank(tag = "TP")
# Select a database:
- choosebank("emblTP", tag = "TP")
+ choosebank("emblTP", tag = "TP")
# Do something with the database:
myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
Modified: pkg/man/countfreelists.Rd
===================================================================
--- pkg/man/countfreelists.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/countfreelists.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -3,8 +3,8 @@
\alias{cfl}
\title{The number of free lists available and annotation lines in an ACNUC server}
\description{
-Returns the number of free lists available list of names of annotation lines in the
-opened ACNUC database.
+Returns the number of free lists available list of names of annotation lines in the
+opened ACNUC database.
}
\usage{
countfreelists(socket = autosocket())
@@ -21,7 +21,7 @@
\item{free}{numeric. The number of free lists}
\item{annotlines}{vector of strings. Names of annotation lines}
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -31,9 +31,9 @@
\dontrun{ # Need internet connection
choosebank("emblTP")
(rescountfreelists <- countfreelists())
- stopifnot(all(rescountfreelists$annotlines ==
+ stopifnot(all(rescountfreelists$annotlines ==
c("ALL", "AC", "PR", "DT", "KW", "OS", "OC",
- "OG", "RN", "RC", "RP", "RX", "RG", "RA", "RT", "RL", "DR",
+ "OG", "RN", "RC", "RP", "RX", "RG", "RA", "RT", "RL", "DR",
"CC", "AH", "AS", "FH", "FT", "CO", "SQ", "SEQ")))
closebank()
}
Modified: pkg/man/countsubseqs.Rd
===================================================================
--- pkg/man/countsubseqs.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/countsubseqs.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -3,7 +3,7 @@
\alias{css}
\title{Number of subsequences in an ACNUC list}
\description{
-Returns the number of subsequences in the ACNUC list of rank \code{lrank}.
+Returns the number of subsequences in the ACNUC list of rank \code{lrank}.
}
\usage{
countsubseqs(lrank, socket = autosocket())
@@ -18,7 +18,7 @@
\value{
Numeric.
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
Modified: pkg/man/getliststate.Rd
===================================================================
--- pkg/man/getliststate.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/getliststate.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -26,12 +26,12 @@
\item{type}{string. Type of ACNUC list (SQ, KW, SP)}
\item{name}{string. ACNUC list name}
\item{count}{numeric. Number of elements in ACNUC list}
- \item{locus}{logical. For ACNUC sequence lists TRUE means that the list
+ \item{locus}{logical. For ACNUC sequence lists TRUE means that the list
contains only parent sequences. NA otherwise.}
\code{gln} is a shortcut for \code{getliststate(lrank, ...)$name}
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -39,7 +39,7 @@
\seealso{\code{\link{choosebank}}, \code{\link{query}}, \code{\link{alr}},
\code{\link{glr}} }
\examples{
-\dontrun{
+\dontrun{
### Need internet connection
choosebank("emblTP")
mylist <- query("mylist", "sp=felis catus et t=cds", virtual=TRUE)
Modified: pkg/man/gfrag.Rd
===================================================================
--- pkg/man/gfrag.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/gfrag.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -2,8 +2,8 @@
\alias{gfrag}
\title{Extract sequence identified by name or by number from an ACNUC server}
\description{
-Get \code{length} characters from sequence identified by name or by number
-starting from position \code{start} (counted from 1).
+Get \code{length} characters from sequence identified by name or by number
+starting from position \code{start} (counted from 1).
}
\usage{
gfrag(what, start, length, idby = c("name", "number"), socket = autosocket())
@@ -17,11 +17,11 @@
database (default is a socket to the last opened database).}
}
\value{
-A string of characters with at most \code{length} characters (may be
+A string of characters with at most \code{length} characters (may be
shorter than asked for). NA is returned and a warning is issued in
case of problem (non existent sequence for instance).
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -32,6 +32,6 @@
choosebank("emblTP")
gfrag("LMFLCHR36", start = 1, length = 3529852) -> myseq
stopifnot(nchar(myseq) == 3529852)
- closebank()
+ closebank()
}
}
Modified: pkg/man/ghelp.Rd
===================================================================
--- pkg/man/ghelp.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/ghelp.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -24,7 +24,7 @@
A vector of string which is returned invisibly and "cated" to the console
by default.
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -31,7 +31,7 @@
\author{J.R. Lobry}
\seealso{\code{\link{choosebank}}, \code{\link{query}} }
\examples{
-\dontrun{
+\dontrun{
### Need internet connection
choosebank("emblTP")
ghelp()
Modified: pkg/man/isenum.Rd
===================================================================
--- pkg/man/isenum.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/isenum.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -27,21 +27,21 @@
\item{number}{numeric. The ACNUC number of the sequence.}
\item{length}{numeric. The length of the sequence.}
- \item{frame}{numeric. The reading frame (0, 1, or 2) of the sequence for CDS.}
+ \item{frame}{numeric. The reading frame (0, 1, or 2) of the sequence for CDS.}
\item{gencode}{numeric. ACNUC's genetic code (0 means universal) of the sequence for CDS.}
\item{ncbigc}{numeric. NCBI's genetic code (0 means universal) of the sequence for CDS.}
- \item{otheraccessmatches}{logical. If TRUE it means that several sequences are attached
- to the given accession nunmber, and that only the ACNUC number of the first attached
+ \item{otheraccessmatches}{logical. If TRUE it means that several sequences are attached
+ to the given accession nunmber, and that only the ACNUC number of the first attached
sequence is returned in the \code{number} component of the list.}
\code{isn(what, ...)} is a shortcut for \code{isenum(what, ...)$number}.\cr
As from seqinR 1.1-3 \code{getNumber.socket} and
-\code{getAttributsocket} are deprecated (a warning is issued).
+\code{getAttributsocket} are deprecated (a warning is issued).
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -48,7 +48,7 @@
\author{J.R. Lobry}
\seealso{\code{\link{choosebank}}, \code{\link{query}} }
\examples{
-\dontrun{
+\dontrun{
### Need internet connection
choosebank("emblTP")
isenum("LMFLCHR36")
Modified: pkg/man/kaks.Rd
===================================================================
--- pkg/man/kaks.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/kaks.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -1,7 +1,7 @@
\name{kaks}
\alias{kaks}
\title{Ka and Ks, also known as dn and ds, computation}
-\description{ Ks and Ka are, respectively, the number of substitutions per synonymous site and per non-synonymous site between two protein-coding genes. They are also denoted as ds and dn in the literature. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitution rates is an indicator of selective pressures on genes. A ratio significantly greater than 1 indicates positive selective pressure. A ratio around 1 indicates either neutral evolution at the protein level or an averaging of sites under positive and negative selective pressures. A ratio less than 1 indicates pressures to conserve protein sequence (\emph{i.e.} purifying selection). This function estimates the Ka and Ks values for a set of aligned sequences using the method published by Li (1993) and gives the associated variance matrix.
+\description{ Ks and Ka are, respectively, the number of substitutions per synonymous site and per non-synonymous site between two protein-coding genes. They are also denoted as ds and dn in the literature. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitution rates is an indicator of selective pressures on genes. A ratio significantly greater than 1 indicates positive selective pressure. A ratio around 1 indicates either neutral evolution at the protein level or an averaging of sites under positive and negative selective pressures. A ratio less than 1 indicates pressures to conserve protein sequence (\emph{i.e.} purifying selection). This function estimates the Ka and Ks values for a set of aligned sequences using the method published by Li (1993) and gives the associated variance matrix.
}
\usage{
kaks(x, verbose = FALSE, debug = FALSE, forceUpperCase = TRUE, rmgap = TRUE)
@@ -11,7 +11,7 @@
\item{verbose}{ If TRUE add to the results the value of L0, L2, L4 (respectively the frequency of non-synonymous sites, of 2-fold synonymous sites, of 4-fold synonymous sites), A0, A2, A4 (respectively the number of transitional changes at non-synonymous, 2-fold, and 4-fold synonymous sites ) and B0, B2, B4 (respectively the number of transversional changes at non-synonymous, 2-fold, and 4-fold synonymous sites).}
\item{debug}{ If TRUE turns debug mode on.}
\item{forceUpperCase}{ If TRUE, the default value, all character in sequences are forced to the upper case
- if at least one 'a', 'c', 'g', or 't' is found in the sequences.
+ if at least one 'a', 'c', 'g', or 't' is found in the sequences.
Turning it to FALSE if the sequences are already in upper case will save time.}
\item{rmgap}{ If TRUE all positions with at least one gap are removed. If FALSE only positions with nothing else than gaps are removed.}
}
@@ -19,17 +19,17 @@
\item{ ks }{ matrix of Ks values }
\item{ ka }{ matrix of Ka values }
\item{ vks }{ variance matrix of Ks }
- \item{ vka }{ variance matrix of Ka }
+ \item{ vka }{ variance matrix of Ka }
}
\references{
Li, W.-H., Wu, C.-I., Luo, C.-C. (1985) A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. \emph{Mol. Biol. Evol}, \bold{2}:150-174\cr
-Li, W.-H. (1993) Unbiased estimation of the rates of synonymous and nonsynonymous substitution. \emph{J. Mol. Evol.}, \bold{36}:96-99.\cr
+Li, W.-H. (1993) Unbiased estimation of the rates of synonymous and nonsynonymous substitution. \emph{J. Mol. Evol.}, \bold{36}:96-99.\cr
Pamilo, P., Bianchi, N.O. (1993) Evolution of the \emph{Zfx} and \emph{Zfy} genes: Rates and interdependence between genes. \emph{Mol. Biol. Evol}, \bold{10}:271-281\cr
Hurst, L.D. (2002) The Ka/Ks ratio: diagnosing the form of sequence evolution.
-\emph{Trends Genet.}, \bold{18}:486-486.\cr
+\emph{Trends Genet.}, \bold{18}:486-486.\cr
The C programm implementing this method was provided by Manolo Gouy. More info is
needed here to trace back the original C source so as to credit correct source.
@@ -38,21 +38,21 @@
For a more recent discussion about the estimation of Ka and Ks see:\cr
-Tzeng, Y.H., Pan, R., Li, W.-H. (2004) Comparison of three methods for estimating
+Tzeng, Y.H., Pan, R., Li, W.-H. (2004) Comparison of three methods for estimating
rates of synonymous and nonsynonymous nucleotide substitutions.
\emph{Mol. Biol. Evol}, \bold{21}:2290-2298.\cr
The method implemented here is noted LWL85 in the above paper.\cr
-The cite this package in a publication, as any R package, try something as \code{citation("seqinr")}
+The cite this package in a publication, as any R package, try something as \code{citation("seqinr")}
at your R prompt.
}
-\note{
+\note{
Computing Ka and Ks makes sense for coding sequences that have been aligned at the amino-acid level before retro-translating the alignement at the nucleic acid level to ensure that sequences are compared on a codon-by-codon basis. Function \code{\link{reverse.align}} may help for this.
As from seqinR 2.0-3, when there is at least one non ACGT base in a codon, this codon is considered as a gap-codon (\code{---}). This makes the computation more robust with respect to alignments with out-of-frame gaps, see example section.
-Gap-codons (\code{---}) are not used for computations.
+Gap-codons (\code{---}) are not used for computations.
When the alignment does not contain enough information (\emph{i.e.} close to saturation), the Ka and Ks values are forced to 10 (more exactly to 9.999999).
@@ -63,7 +63,7 @@
Ks = (L2.A2 + L4.A4) / (L2 + L4) + B4
and the rate of non-synonymous substitutions Ka is computed as:
-Ka = A0 + (L0.B0 + L2.B2) / (L0 + L2)
+Ka = A0 + (L0.B0 + L2.B2) / (L0 + L2)
}
\author{D. Charif, J.R. Lobry}
@@ -81,7 +81,7 @@
#
data(AnoukResult)
Anouk <- read.alignment(file = system.file("sequences/Anouk.fasta", package = "seqinr"),
- format = "fasta")
+ format = "fasta")
if( ! all.equal(kaks(Anouk), AnoukResult) ) {
warning("Poor numeric results with respect to AnoukResult standard")
} else {
@@ -98,7 +98,7 @@
# AT-TGGTCCAGGTATCGTAAGCTAGGGATATCGATTATATATAGCAAGATCGATAGGGGA
# TCGATGATCGATCGGGA--GACAGCTG
#
-# This test example provided by Darren Obbard is now used as a routine check:
+# This test example provided by Darren Obbard is now used as a routine check:
#
Darren <- read.alignment(file = system.file("sequences/DarrenObbard.fasta", package = "seqinr"),
format = "fasta")
Modified: pkg/man/knowndbs.Rd
===================================================================
--- pkg/man/knowndbs.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/knowndbs.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -3,8 +3,8 @@
\alias{kdb}
\title{Description of databases known by an ACNUC server}
\description{
-Returns, for each database known by the server, its name (a valid value for the \code{bank}
-argument of \code{\link{choosebank}}), availability (off means temporarily unavailable),
+Returns, for each database known by the server, its name (a valid value for the \code{bank}
+argument of \code{\link{choosebank}}), availability (off means temporarily unavailable),
and description.
}
\usage{
@@ -18,10 +18,10 @@
}
\details{
-When the optional \code{tag} argument is used, only databases tagged with the given
+When the optional \code{tag} argument is used, only databases tagged with the given
string are listed;
when this argument is NA (by default), only untagged databases are listed.
-The \code{tag} argument thus allows to identify series of special purpose (tagged) databases,
+The \code{tag} argument thus allows to identify series of special purpose (tagged) databases,
in addition to default (untagged) ones.
}
@@ -31,18 +31,18 @@
\item{status}{string. "on" means available, "off" means temporarily unavailable}
\item{info}{string. short description of the database}
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
-The full list of untagged and tagged databases is here :
-\url{http://doua.prabi.fr/databases/acnuc/banques_raa.php}.
+The full list of untagged and tagged databases is here :
+\url{https://doua.prabi.fr/databases/acnuc/banques_raa.php}.
}
\author{J.R. Lobry}
\seealso{\code{\link{choosebank}} when called without arguments. }
\examples{
-\dontrun{
+\dontrun{
### Need internet connection
choosebank("emblTP")
kdb()
Modified: pkg/man/modifylist.Rd
===================================================================
--- pkg/man/modifylist.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/modifylist.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -3,11 +3,11 @@
\title{Modification of an ACNUC list}
\description{
This function modifies a previously existing ACNUC list by selecting sequences
-either by length, either by date, either for the presence of a given string in annotations.
+either by length, either by date, either for the presence of a given string in annotations.
}
\usage{
-modifylist(listname, modlistname = listname, operation,
- type = c("length", "date", "scan"), socket = autosocket(),
+modifylist(listname, modlistname = listname, operation,
+ type = c("length", "date", "scan"), socket = autosocket(),
virtual = FALSE, verbose = FALSE)
}
\arguments{
@@ -24,7 +24,7 @@
}
\details{
-Example of possible values for the argument \code{operation}:
+Example of possible values for the argument \code{operation}:
\describe{
\item{length}{as in "> 10000" or "< 500"}
@@ -46,9 +46,9 @@
\item{req}{a list of sequence names that fit the required criteria or \code{NA} when
called with parameter \code{virtual} is \code{TRUE}}
\item{socket}{the socket connection that was used}
-
+
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
Modified: pkg/man/pK.Rd
===================================================================
--- pkg/man/pK.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/pK.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -25,7 +25,7 @@
\emph{Electrophoresis}, \bold{14}:1023-1031.
EMBOSS data were from release 5.0 and were still the same in release 6.6
-\url{http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/iep.html}
+\url{https://emboss.sourceforge.net/apps/release/6.6/emboss/apps/iep.html}
last visited 2016-06-03.
Murray, R.K., Granner, D.K., Rodwell, V.W. (2006)
@@ -33,7 +33,7 @@
27th edition. Published by The McGraw-Hill Companies.
Sillero, A., Maldonado, A. (2006) Isoelectric point determination of proteins
-and other macromolecules: oscillating method.
+and other macromolecules: oscillating method.
\emph{Comput Biol Med.}, \bold{36}:157-166.
Solomon, T.W.G. (1998) \emph{Fundamentals of Organic Chemistry}, 5th edition.
@@ -53,7 +53,7 @@
cTermR <- which(LETTERS == prot[length(seq)])
computeCharge <- function(pH, compoAA, pK, nTermResidue, cTermResidue){
- cter <- 10^(-SEQINR.UTIL$pk[cTermResidue,1]) /
+ cter <- 10^(-SEQINR.UTIL$pk[cTermResidue,1]) /
(10^(-SEQINR.UTIL$pk[cTermResidue,1]) + 10^(-pH))
nter <- 10^(-pH) / (10^(-SEQINR.UTIL$pk[nTermResidue,2]) + 10^(-pH))
carg <- as.vector(compoAA['R'] * 10^(-pH) / (10^(-pK['R']) + 10^(-pH)))
Modified: pkg/man/plot.SeqAcnucWeb.Rd
===================================================================
--- pkg/man/plot.SeqAcnucWeb.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/plot.SeqAcnucWeb.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -2,7 +2,7 @@
\alias{plot.SeqAcnucWeb}
\title{To Plot Subsequences on the Parent Sequence}
\description{
- This function plots all the type of subsequences on a parent sequence. Subsequences are represented by colored rectangle on the parent sequence. For example, types could be CDS, TRNA, RRNA .... In order to get all the types that are available for the selected database, use \code{getType}.
+ This function plots all the type of subsequences on a parent sequence. Subsequences are represented by colored rectangle on the parent sequence. For example, types could be CDS, TRNA, RRNA .... In order to get all the types that are available for the selected database, use \code{getType}.
}
\usage{
\method{plot}{SeqAcnucWeb}(x, types = getType()$sname, socket = autosocket(), ...)
@@ -13,12 +13,12 @@
all possible subsequence types.}
\item{socket}{an object of class \code{sockconn} connecting to a remote ACNUC
database (default is a socket to the last opened database).}
- \item{\dots}{not currently used}
+ \item{\dots}{not currently used}
}
\value{
An invisible list giving, for each subsequence, its position on the parent sequence.
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -25,10 +25,10 @@
\author{D. Charif, J.R. Lobry}
\seealso{\code{\link{getType}}, \code{\link{query}} }
\examples{
-\dontrun{
+\dontrun{
### Need internet connection
choosebank("emblTP")
- mylist <- query("mylist", "AC=AB078009")
+ mylist <- query("mylist", "AC=AB078009")
plot(mylist$req[[1]])
}
}
Modified: pkg/man/prettyseq.Rd
===================================================================
--- pkg/man/prettyseq.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/prettyseq.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -3,8 +3,8 @@
\title{Text representation of a sequence from an ACNUC server}
\description{
To get a text representation of sequence of rank \code{num} and of its subsequences,
-with \code{bpl} bases per line (default = 60), and with optional translation of
-protein-coding subsequences
+with \code{bpl} bases per line (default = 60), and with optional translation of
+protein-coding subsequences
}
\usage{
prettyseq(num, bpl = 60, translate = TRUE, socket = autosocket())
@@ -19,7 +19,7 @@
\value{
An invisible vector of string. The output is redirected to the console.
}
-\references{ \url{http://doua.prabi.fr/databases/acnuc.html}
+\references{ \url{https://doua.prabi.fr/databases/acnuc.html}
\code{citation("seqinr")}
}
@@ -26,7 +26,7 @@
\author{J.R. Lobry}
\seealso{\code{\link{choosebank}}, \code{\link{query}} }
\examples{
-\dontrun{
+\dontrun{
### Need internet connection
choosebank("emblTP")
prettyseq(111)
Modified: pkg/man/query.Rd
===================================================================
--- pkg/man/query.Rd 2022-11-28 14:23:35 UTC (rev 2151)
+++ pkg/man/query.Rd 2022-11-28 14:42:34 UTC (rev 2152)
@@ -5,7 +5,7 @@
This is a major command of the package. It executes all sequence retrievals using any selection criteria the data base allows. The sequences are coming from ACNUC data base located on the web and they are transfered by socket. The command produces the list of all sequence names that fit the required criteria. The sequence names belong to the class of sequence \code{SeqAcnucWeb}.
}
\usage{
-query(listname, query, socket = autosocket(),
+query(listname, query, socket = autosocket(),
invisible = TRUE, verbose = FALSE, virtual = FALSE)
}
\arguments{
@@ -16,17 +16,17 @@
\item{invisible}{if \code{FALSE}, the result is returned visibly.}
\item{verbose}{if \code{TRUE}, verbose mode is on}
\item{virtual}{if \code{TRUE}, no attempt is made to retrieve the information about
- all the elements of the list. In this case, the \code{req} component of the list is set to
+ all the elements of the list. In this case, the \code{req} component of the list is set to
\code{NA}.}
}
\details{
-The query language defines several selection criteria and operations between
-lists of elements matching criteria. It creates mainly lists of sequences, but
+The query language defines several selection criteria and operations between
+lists of elements matching criteria. It creates mainly lists of sequences, but
also lists of species (or, more generally, taxa) and of keywords.
-See \url{http://doua.prabi.fr/databases/acnuc/cfonctions.html#QUERYLANGUAGE}
+See \url{https://doua.prabi.fr/databases/acnuc/cfonctions.html#QUERYLANGUAGE}
for the last update of the description of the query language.\cr
-Selection criteria (no space before the = sign) are:
+Selection criteria (no space before the = sign) are:
\describe{
\item{SP=taxon}{seqs attached to taxon or any other below in tree; @ wildcard possible}
\item{TID=id}{seqs attached to given numerical NCBI's taxon id}
@@ -60,9 +60,9 @@
\item{SD}{compute the list of species placed in the tree below the members of the species list operand}
\item{KD}{compute the list of keywords placed in the tree below the members of the keywords list operand}
}
-The query language is case insensitive.Three operators (AND, OR, NOT)
-can be ambiguous because they can also occur within valid criterion values.
-Such ambiguities can be solved by encapsulating elementary selection
[TRUNCATED]
To get the complete diff run:
svnlook diff /svnroot/seqinr -r 2152
More information about the Seqinr-commits
mailing list