[Seqinr-commits] r1929 - pkg/man
noreply at r-forge.r-project.org
noreply at r-forge.r-project.org
Fri Jun 3 18:25:25 CEST 2016
Author: jeanlobry
Date: 2016-06-03 18:25:25 +0200 (Fri, 03 Jun 2016)
New Revision: 1929
Modified:
pkg/man/AAstat.Rd
pkg/man/AnoukResult.Rd
pkg/man/GC.Rd
pkg/man/SeqAcnucWeb.Rd
pkg/man/SeqFastaAA.Rd
pkg/man/SeqFrag.Rd
pkg/man/a.Rd
pkg/man/aaa.Rd
pkg/man/amb.Rd
pkg/man/as.alignment.Rd
pkg/man/bma.Rd
pkg/man/c2s.Rd
pkg/man/choosebank.Rd
pkg/man/comp.Rd
pkg/man/computePI.Rd
pkg/man/consensus.Rd
pkg/man/count.Rd
pkg/man/dia.bactgensize.Rd
pkg/man/dist.alignment.Rd
pkg/man/dotchart.uco.Rd
pkg/man/draw.oriloc.Rd
pkg/man/draw.rearranged.oriloc.Rd
pkg/man/draw.recstat.Rd
pkg/man/extract.breakpoints.Rd
pkg/man/extractseqs.Rd
pkg/man/fastacc.Rd
pkg/man/gb2fasta.Rd
pkg/man/gbk2g2.Rd
pkg/man/gbk2g2.euk.Rd
pkg/man/get.db.growth.Rd
pkg/man/get.ncbi.Rd
pkg/man/getAnnot.Rd
pkg/man/getFrag.Rd
pkg/man/getKeyword.Rd
pkg/man/getLength.Rd
pkg/man/getLocation.Rd
pkg/man/getName.Rd
pkg/man/getSequence.Rd
pkg/man/getTrans.Rd
pkg/man/getType.Rd
pkg/man/kaks.Rd
pkg/man/lseqinr.Rd
pkg/man/move.Rd
pkg/man/n2s.Rd
pkg/man/oriloc.Rd
pkg/man/permutation.Rd
pkg/man/plot.SeqAcnucWeb.Rd
pkg/man/query.Rd
pkg/man/read.alignment.Rd
pkg/man/read.fasta.Rd
pkg/man/rearranged.oriloc.Rd
pkg/man/recstat.Rd
pkg/man/reverse.align.Rd
pkg/man/s2c.Rd
pkg/man/seqinr-package.Rd
pkg/man/splitseq.Rd
pkg/man/swap.Rd
pkg/man/syncodons.Rd
pkg/man/synsequence.Rd
pkg/man/tablecode.Rd
pkg/man/test.co.recstat.Rd
pkg/man/test.li.recstat.Rd
pkg/man/translate.Rd
pkg/man/uco.Rd
pkg/man/ucoweight.Rd
pkg/man/words.Rd
pkg/man/words.pos.Rd
pkg/man/write.fasta.Rd
pkg/man/zscore.Rd
Log:
authors polishing including UTF-8
Modified: pkg/man/AAstat.Rd
===================================================================
--- pkg/man/AAstat.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/AAstat.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -23,7 +23,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{ \code{\link{computePI}}, \code{\link{SEQINR.UTIL}}, \code{\link{SeqFastaAA}}}
\examples{
seqAA <- read.fasta(file = system.file("sequences/seqAA.fasta", package = "seqinr"),
Modified: pkg/man/AnoukResult.Rd
===================================================================
--- pkg/man/AnoukResult.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/AnoukResult.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -21,7 +21,7 @@
See the example in \code{\link{kaks}}.
}
\source{
-The fasta test file was provided by Anamaria Necsulea.
+The fasta test file was provided by Anamaria Necşulea.
}
\references{
\code{citation("seqinr")}
Modified: pkg/man/GC.Rd
===================================================================
--- pkg/man/GC.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/GC.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -88,7 +88,7 @@
character and \code{\link{tolower}} to convert upper-case characters into
lower-case characters. Do not confuse with \code{\link{gc}} for garbage collection.
}
-\author{D. Charif and L. Palmeira and J.R. Lobry}
+\author{D. Charif, L. Palmeira, J.R. Lobry}
\examples{
mysequence <- s2c("agtctggggggccccttttaagtagatagatagctagtcgta")
GC(mysequence) # 0.4761905
Modified: pkg/man/SeqAcnucWeb.Rd
===================================================================
--- pkg/man/SeqAcnucWeb.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/SeqAcnucWeb.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -26,7 +26,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\examples{
\dontrun{# Need internet connection
choosebank("emblTP")
Modified: pkg/man/SeqFastaAA.Rd
===================================================================
--- pkg/man/SeqFastaAA.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/SeqFastaAA.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -29,7 +29,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif }
+\author{D. Charif}
\examples{
s <- read.fasta(file = system.file("sequences/seqAA.fasta", package = "seqinr"), seqtype="AA")
is.SeqFastaAA(s[[1]])
Modified: pkg/man/SeqFrag.Rd
===================================================================
--- pkg/man/SeqFrag.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/SeqFrag.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -24,7 +24,7 @@
\item{class}{ \code{SeqFrag} which is the classfor sub-sequence }
\code{is.SeqFrag} returns TRUE if the object is of class Seqfrag.
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\references{
\code{citation("seqinr")}
}
Modified: pkg/man/a.Rd
===================================================================
--- pkg/man/a.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/a.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -25,7 +25,7 @@
\url{http://www.chem.qmul.ac.uk/iupac/AminoAcid/}\cr
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry }
\seealso{\code{\link{aaa}}, \code{\link{translate}} }
\examples{
#
Modified: pkg/man/aaa.Rd
===================================================================
--- pkg/man/aaa.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/aaa.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -23,7 +23,7 @@
\url{http://www.chem.qmul.ac.uk/iupac/AminoAcid/}
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{\code{\link{a}}, \code{\link{translate}} }
\examples{
#
Modified: pkg/man/amb.Rd
===================================================================
--- pkg/man/amb.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/amb.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -30,7 +30,7 @@
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{See \code{\link{bma}} for the reverse operation.
Use \code{\link{tolower}} to change upper case letters into
Modified: pkg/man/as.alignment.Rd
===================================================================
--- pkg/man/as.alignment.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/as.alignment.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -24,7 +24,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{
\code{\link{read.alignment}},
\code{\link{as.matrix.alignment}}, \code{\link{read.fasta}},
Modified: pkg/man/bma.Rd
===================================================================
--- pkg/man/bma.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/bma.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -27,7 +27,7 @@
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{See \code{\link{amb}} for the reverse operation.
Use \code{\link{toupper}} to change lower case letters into
Modified: pkg/man/c2s.Rd
===================================================================
--- pkg/man/c2s.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/c2s.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -15,7 +15,7 @@
\value{
a string
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\references{
\code{citation("seqinr")}
}
Modified: pkg/man/choosebank.Rd
===================================================================
--- pkg/man/choosebank.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/choosebank.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -76,7 +76,7 @@
The invisible list returned when a database is opened is stored in the variable
\code{banknameSocket} in the global environment.
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{\code{\link{where.is.this.acc}} if you have a sequence accession number but you
don't know which database to open, \code{\link{query}} to make a query when a database
is opened, \code{\link{connection}}, \code{\link{socketConnection}} }
Modified: pkg/man/comp.Rd
===================================================================
--- pkg/man/comp.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/comp.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -20,7 +20,7 @@
not the reverse complementary strand. Undefined values are
returned as NA.
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\references{
\code{citation("seqinr")}
}
Modified: pkg/man/computePI.Rd
===================================================================
--- pkg/man/computePI.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/computePI.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -20,7 +20,7 @@
in case of convergence failure of the non-linear regression procedure.
\code{citation("seqinr")}
}
-\author{D. Charif and J.R. Lobry}
+\author{D. Charif, J.R. Lobry}
\note{
Protein pI is calculated using pK values of amino acids described in Bjellqvist et al. See also \code{SEQINR.UTIL} for more details.
}
Modified: pkg/man/consensus.Rd
===================================================================
--- pkg/man/consensus.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/consensus.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -52,7 +52,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{See \code{\link{read.alignment}} to import alignment from files.}
Modified: pkg/man/count.Rd
===================================================================
--- pkg/man/count.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/count.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -30,7 +30,7 @@
oligomers. All oligomers are returned, even if absent from
the sequence.
}
-\author{ D. Charif, J.R. Lobry with suggestions from Gabriel Valiente, Stefanie Hartmann and Christian Gautier}
+\author{D. Charif, J.R. Lobry with suggestions from Gabriel Valiente, Stefanie Hartmann and Christian Gautier}
\references{
\code{citation("seqinr")}
}
Modified: pkg/man/dia.bactgensize.Rd
===================================================================
--- pkg/man/dia.bactgensize.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/dia.bactgensize.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -65,7 +65,7 @@
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{density}} }
\examples{
#
Modified: pkg/man/dist.alignment.Rd
===================================================================
--- pkg/man/dist.alignment.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/dist.alignment.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -30,7 +30,7 @@
\code{citation("seqinr")}
}
-\author{D. Charif and J.R. Lobry}
+\author{D. Charif, J.R. Lobry}
\seealso{ \code{\link{read.alignment} } }
\examples{
myseqs <- read.alignment(file = system.file("sequences/test.mase",
Modified: pkg/man/dotchart.uco.Rd
===================================================================
--- pkg/man/dotchart.uco.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/dotchart.uco.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -38,7 +38,7 @@
Monterey, CA: Wadsworth.
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{dotchart}}, \code{\link{uco}}, \code{\link{aaa}},
\code{\link{translate}} }
\examples{
Modified: pkg/man/draw.oriloc.Rd
===================================================================
--- pkg/man/draw.oriloc.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/draw.oriloc.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -42,7 +42,7 @@
\code{citation("seqinr")}
}
-\author{Jean R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{oriloc}}, \code{\link{rearranged.oriloc}},
\code{\link{extract.breakpoints}} }
Modified: pkg/man/draw.rearranged.oriloc.Rd
===================================================================
--- pkg/man/draw.rearranged.oriloc.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/draw.rearranged.oriloc.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -30,11 +30,11 @@
}
\references{
- Necsulea, A. and Lobry, J.R. (2007) A New Method for Assessing the
+ Necşulea, A. and Lobry, J.R. (2007) A New Method for Assessing the
Effect of Replication on DNA Base Composition Asymmetry.
\emph{Molecular Biology and Evolution}, \bold{24}:2169-2179.
}
-\author{Jean R. Lobry and A. Necsulea }
+\author{J.R. Lobry, A. Necşulea}
\seealso{ \code{\link{rearranged.oriloc}},
\code{\link{extract.breakpoints}} }
Modified: pkg/man/draw.recstat.Rd
===================================================================
--- pkg/man/draw.recstat.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/draw.recstat.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -22,7 +22,7 @@
sequence, the factor scores for the windows located in the corresponding reading frame will be
significantly separated from the two others. Moreover, the region where this separation is seen
should be located between a Start and a Stop codon.}
-\author{Clerc, O. and Perriere, G.}
+\author{O. Clerc, G. Perrière}
\seealso{\code{\link{test.li.recstat}}, \code{\link{test.co.recstat}}}
\examples{
ff <- system.file("sequences/ECOUNC.fsa", package = "seqinr")
Modified: pkg/man/extract.breakpoints.Rd
===================================================================
--- pkg/man/extract.breakpoints.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/extract.breakpoints.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -55,12 +55,13 @@
\references{
\code{citation("segmented")}
-
- Necsulea, A. and Lobry, J.R. (in prep) A novel method for assessing
+ Necşulea, A. and Lobry, J.R. (in prep) A novel method for assessing
the effect of replication on DNA base composition asymmetry.
+ \emph{Molecular Biology and Evolution},\bold{24}:2169-2179.
+
}
-\author{A. Necsulea}
+\author{A. Necşulea}
\seealso{ \code{\link{oriloc}}, \code{\link{draw.rearranged.oriloc}},
\code{\link{rearranged.oriloc}} }
Modified: pkg/man/extractseqs.Rd
===================================================================
--- pkg/man/extractseqs.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/extractseqs.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -69,7 +69,7 @@
\references{
\code{citation("seqinr")}
}
-\author{S.Penel}
+\author{S. Penel}
\seealso{
\code{\link{choosebank}},
\code{\link{query}}
Modified: pkg/man/fastacc.Rd
===================================================================
--- pkg/man/fastacc.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/fastacc.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -32,9 +32,7 @@
\references{
\code{citation("seqinr")}
}
-\author{
-J.R. Lobry
-}
+\author{J.R. Lobry}
\section{Warning }{Experimental, first release schedulded for seqinr 2.0-6 by the end of 2009}
Modified: pkg/man/gb2fasta.Rd
===================================================================
--- pkg/man/gb2fasta.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/gb2fasta.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -22,7 +22,7 @@
\references{
\code{citation("seqinr")}
}
-\author{J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{oriloc}} }
\examples{
\dontrun{gb2fasta()} # need internet connection
Modified: pkg/man/gbk2g2.Rd
===================================================================
--- pkg/man/gbk2g2.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/gbk2g2.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -24,7 +24,7 @@
\references{
\code{citation("seqinr")}
}
-\author{J.R. lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{oriloc}} which uses glimmer-like files,
\code{\link{gbk2g2.euk}} for eukaryotic sequences with introns.}
\examples{
Modified: pkg/man/gbk2g2.euk.Rd
===================================================================
--- pkg/man/gbk2g2.euk.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/gbk2g2.euk.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -30,7 +30,7 @@
\references{
\code{citation("seqinr")}
}
-\author{J.R. Lobry and A. Necsulea}
+\author{J.R. Lobry, A. Necşulea}
\seealso{ \code{\link{oriloc}}, \code{\link{gbk2g2}} }
\examples{
\dontrun{ gbk2g2.euk() }
Modified: pkg/man/get.db.growth.Rd
===================================================================
--- pkg/man/get.db.growth.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/get.db.growth.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -28,7 +28,7 @@
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\examples{
\dontrun{data <- get.db.growth()}
\dontrun{dia.db.growth(data)}
Modified: pkg/man/get.ncbi.Rd
===================================================================
--- pkg/man/get.ncbi.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/get.ncbi.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -27,7 +27,7 @@
\references{
\code{citation("seqinr")}
}
-\author{J.R. Lobry }
+\author{J.R. Lobry}
\section{WARNING }{
This function is highly dependant on ncbi ftp site conventions
for which we have no control.
Modified: pkg/man/getAnnot.Rd
===================================================================
--- pkg/man/getAnnot.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getAnnot.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -36,7 +36,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{query}}, \code{\link{SeqAcnucWeb}}, \code{\link{c2s}}, \code{\link{translate}} and \code{\link{prepgetannots}} to select the annotation lines.
}
Modified: pkg/man/getFrag.Rd
===================================================================
--- pkg/man/getFrag.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getFrag.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -39,7 +39,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}, \code{\link{SeqFastadna}}, \code{\link{SeqFastaAA}}, \code{\link{SeqFrag}}
}
Modified: pkg/man/getKeyword.Rd
===================================================================
--- pkg/man/getKeyword.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getKeyword.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -28,7 +28,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}
}
Modified: pkg/man/getLength.Rd
===================================================================
--- pkg/man/getLength.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getLength.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -28,7 +28,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}, \code{\link{SeqFastadna}},
\code{\link{SeqFastaAA}}, \code{\link{SeqFrag}}
Modified: pkg/man/getLocation.Rd
===================================================================
--- pkg/man/getLocation.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getLocation.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -31,7 +31,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}
}
Modified: pkg/man/getName.Rd
===================================================================
--- pkg/man/getName.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getName.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -26,7 +26,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}, \code{\link{SeqFastadna}},
\code{\link{SeqFastaAA}}, \code{\link{SeqFrag}}
Modified: pkg/man/getSequence.Rd
===================================================================
--- pkg/man/getSequence.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getSequence.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -35,7 +35,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}, \code{\link{SeqFastadna}},
\code{\link{SeqFastaAA}}, \code{\link{SeqFrag}}
Modified: pkg/man/getTrans.Rd
===================================================================
--- pkg/man/getTrans.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getTrans.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -65,7 +65,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif and J.R. Lobry and L. Palmeira}
+\author{D. Charif, J.R. Lobry, L. Palmeira}
\seealso{
\code{\link{SeqAcnucWeb}}, \code{\link{SeqFastadna}}, \code{\link{SeqFrag}}\cr
The genetic codes are given in the object \code{\link{SEQINR.UTIL}}, a more
Modified: pkg/man/getType.Rd
===================================================================
--- pkg/man/getType.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/getType.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -19,7 +19,7 @@
\references{
\code{citation("seqinr")}
}
-\author{D. Charif and J.R. Lobry}
+\author{D. Charif, J.R. Lobry}
\seealso{ \code{\link{choosebank}}, \code{\link{query}} }
\examples{
\dontrun{
Modified: pkg/man/kaks.Rd
===================================================================
--- pkg/man/kaks.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/kaks.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -62,7 +62,7 @@
Ka = A0 + (L0.B0 + L2.B2) / (L0 + L2)
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{\code{\link{read.alignment}} to import alignments from files, \code{\link{reverse.align}} to align CDS at the aa level.}
\examples{
#
Modified: pkg/man/lseqinr.Rd
===================================================================
--- pkg/man/lseqinr.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/lseqinr.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -16,9 +16,7 @@
\note{
Use \code{library(help=seqinr)} to have a summary of the functionc available in the package.
}
-\author{
-J.R. Lobry
-}
+\author{J.R. Lobry}
\examples{
lseqinr()
}
Modified: pkg/man/move.Rd
===================================================================
--- pkg/man/move.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/move.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -19,7 +19,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{\code{\link{swap}} }
\examples{
Modified: pkg/man/n2s.Rd
===================================================================
--- pkg/man/n2s.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/n2s.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -24,7 +24,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{s2n}} }
\examples{
##example of the default behaviour:
Modified: pkg/man/oriloc.Rd
===================================================================
--- pkg/man/oriloc.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/oriloc.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -102,7 +102,7 @@
\code{citation("seqinr")}
}
-\author{ J.R. Lobry and A.C. Frank}
+\author{J.R. Lobry, A.C. Frank}
\seealso{ \code{\link{draw.oriloc}}, \code{\link{rearranged.oriloc}} }
\note{ The method works only for genomes having a single origin of replication
Modified: pkg/man/permutation.Rd
===================================================================
--- pkg/man/permutation.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/permutation.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -44,7 +44,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ Leonor Palmeira }
+\author{L. Palmeira}
\seealso{ \code{\link{synsequence}} }
\examples{
data(ec999)
Modified: pkg/man/plot.SeqAcnucWeb.Rd
===================================================================
--- pkg/man/plot.SeqAcnucWeb.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/plot.SeqAcnucWeb.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -22,7 +22,7 @@
\code{citation("seqinr")}
}
-\author{D. Charif and J.R. Lobry}
+\author{D. Charif, J.R. Lobry}
\seealso{\code{\link{getType}}, \code{\link{query}} }
\examples{
\dontrun{
Modified: pkg/man/query.Rd
===================================================================
--- pkg/man/query.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/query.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -93,7 +93,7 @@
\code{citation("seqinr")}
}
-\author{J.R. Lobry & D. Charif}
+\author{J.R. Lobry, D. Charif}
\note{Most of the documentation was imported from ACNUC help
files written by Manolo Gouy}
\seealso{
Modified: pkg/man/read.alignment.Rd
===================================================================
--- pkg/man/read.alignment.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/read.alignment.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -78,7 +78,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{
To read aligned sequences in NEXUS format, see the function
\code{read.nexus} that was available in the \code{CompPairWise} package
Modified: pkg/man/read.fasta.Rd
===================================================================
--- pkg/man/read.fasta.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/read.fasta.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -80,7 +80,7 @@
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{
\code{\link{write.fasta}} to write sequences in a FASTA file,
\code{\link{gb2fasta}} to convert a GenBank file into a FASTA file,
Modified: pkg/man/rearranged.oriloc.Rd
===================================================================
--- pkg/man/rearranged.oriloc.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/rearranged.oriloc.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -57,12 +57,12 @@
}
\references{
- Necsulea, A. and Lobry, J.R. (2007) A New Method for Assessing the
+ Necşulea, A. and Lobry, J.R. (2007) A New Method for Assessing the
Effect of Replication on DNA Base Composition Asymmetry.
\emph{Molecular Biology and Evolution}, \bold{24}:2169-2179.
}
-\author{A. Necsulea}
+\author{A. Necşulea}
\seealso{ \code{\link{oriloc}}, \code{\link{draw.rearranged.oriloc}},
\code{\link{extract.breakpoints}} }
Modified: pkg/man/recstat.Rd
===================================================================
--- pkg/man/recstat.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/recstat.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -45,7 +45,7 @@
prokaryotic and eukaryotic sequences. Also, only the four first factors of the CA are kept.
Indeed, most of the time, only the first factor is relevant in order to detect CDS.
}
-\author{Clerc, O. and Perriere, G.}
+\author{O. Clerc, G. Perrière}
\references{The original paper describing recstat is:\cr
Fichant, G., Gautier, C. (1987) Statistical method for predicting protein coding
Modified: pkg/man/reverse.align.Rd
===================================================================
--- pkg/man/reverse.align.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/reverse.align.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -61,7 +61,7 @@
\references{
\code{citation('seqinr')}
}
-\author{ A. Necsulea }
+\author{A. Necşulea}
\seealso{ \code{\link{read.alignment}}, \code{\link{read.fasta}}, \code{\link{write.fasta}}}
\examples{
Modified: pkg/man/s2c.Rd
===================================================================
--- pkg/man/s2c.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/s2c.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -19,7 +19,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{c2s}} }
\examples{
stopifnot(all(s2c("BigBang") == c("B", "i", "g", "B", "a", "n", "g")))
Modified: pkg/man/seqinr-package.Rd
===================================================================
--- pkg/man/seqinr-package.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/seqinr-package.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -10,10 +10,9 @@
biological sequence (DNA and protein) data. Include also
utilities for sequence data management under the ACNUC system.
}
-\author{
-Delphine Charif and Jean R. Lobry and Anamaria Necsulea and Leonor Palmeira
-
-Maintainer: Simon Penel <penel at biomserv.univ-lyon1.fr>
+\author{Delphine Charif [aut], Olivier Clerc [ctb], Olivier Clerc [ctb],
+ Jean R. Lobry [aut], Anamaria Necşulea [ctb], Leonor Palmeira [ctb],
+ Simon Penel [cre], Guy Perrière [ctb]}
}
\references{
citation('seqinr')
Modified: pkg/man/splitseq.Rd
===================================================================
--- pkg/man/splitseq.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/splitseq.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -19,7 +19,7 @@
\code{citation("seqinr")}
\cr
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{split}} }
\examples{
cds <- s2c("aacgttgcaggtcgctcgctacgtagctactgttt")
Modified: pkg/man/swap.Rd
===================================================================
--- pkg/man/swap.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/swap.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -17,7 +17,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{\code{\link{move}} }
\examples{
Modified: pkg/man/syncodons.Rd
===================================================================
--- pkg/man/syncodons.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/syncodons.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -16,7 +16,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ Leonor Palmeira, J.R. Lobry }
+\author{L. Palmeira, J.R. Lobry}
\seealso{ \code{\link{synsequence}} }
\examples{
#
Modified: pkg/man/synsequence.Rd
===================================================================
--- pkg/man/synsequence.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/synsequence.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -19,7 +19,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ Leonor Palmeira }
+\author{L. Palmeira}
\seealso{ \code{\link{ucoweight}} }
\examples{
data(ec999)
Modified: pkg/man/tablecode.Rd
===================================================================
--- pkg/man/tablecode.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/tablecode.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -34,7 +34,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{translate}}, \code{\link{syncodons}} }
\examples{
#
Modified: pkg/man/test.co.recstat.Rd
===================================================================
--- pkg/man/test.co.recstat.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/test.co.recstat.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -36,7 +36,7 @@
positions of the region; and \code{CDS} is a binary indicator equal to 1 if a putative CDS is
predicted, and to 0 if not.
}
-\author{Clerc, O. and Perriere, G.}
+\author{O. Clerc, G. Perrière}
\seealso{\code{\link{test.li.recstat}}}
\examples{
ff <- system.file("sequences/ECOUNC.fsa", package = "seqinr")
Modified: pkg/man/test.li.recstat.Rd
===================================================================
--- pkg/man/test.li.recstat.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/test.li.recstat.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -37,7 +37,7 @@
between the means from reading frames \code{i} and \code{j}; and \code{CDS} is a binary
indicator equal to 1 if a putative CDS is predicted, and to 0 if not.
}
-\author{Clerc, O. and Perriere, G.}
+\author{O. Clerc, G. Perrière}
\seealso{\code{\link{test.co.recstat}}}
\examples{
ff <- system.file("sequences/ECOUNC.fsa", package = "seqinr")
Modified: pkg/man/translate.Rd
===================================================================
--- pkg/man/translate.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/translate.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -58,7 +58,7 @@
\code{citation("seqinr")}
}
-\author{ D. Charif, J.R. Lobry }
+\author{D. Charif, J.R. Lobry}
\seealso{
Use \code{\link{tolower}} to change upper case letters into lower case letters.
For coding sequences obtained from an ACNUC server with \code{\link{query}} it's
Modified: pkg/man/uco.Rd
===================================================================
--- pkg/man/uco.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/uco.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -35,7 +35,7 @@
that is used more frequently than expected.\cr
Do not use correspondence analysis on RSCU tables as this is a source of artifacts
- (Perriere and Thioulouse 2002, Suzuki \emph{et al.} 2008). Within-aminoacid correspondence analysis is a
+ (Perrière and Thioulouse 2002, Suzuki \emph{et al.} 2008). Within-aminoacid correspondence analysis is a
simple way to study synonymous codon usage (Charif \emph{et al.} 2005). For an introduction
to correspondence analysis and within-aminoacid correspondence analysis see the
chapter titled \emph{Multivariate analyses} in the seqinR manual that ships with the
@@ -70,14 +70,14 @@
analysis clearly differentiates highly and lowly expressed genes.
\emph{Nucl. Acids. Res.}, \bold{14}:5125-5143.\cr
-Perriere, G., Thioulouse, J. (2002) Use and misuse of correspondence analysis in
+Perrière, G., Thioulouse, J. (2002) Use and misuse of correspondence analysis in
codon usage studies. \emph{Nucl. Acids. Res.}, \bold{30}:4548-4555.\cr
Lobry, J.R., Chessel, D. (2003) Internal correspondence analysis of codon and
amino-acid usage in thermophilic bacteria.
\emph{Journal of Applied Genetics}, \bold{44}:235-261. \url{http://jag.igr.poznan.pl/2003-Volume-44/2/pdf/2003_Volume_44_2-235-261.pdf}.\cr
-Charif, D., Thioulouse, J., Lobry, J.R., Perriere, G. (2005) Online
+Charif, D., Thioulouse, J., Lobry, J.R., Perrière, G. (2005) Online
Synonymous Codon Usage Analyses with the ade4 and seqinR packages.
\emph{Bioinformatics}, \bold{21}:545-547. \url{http://pbil.univ-lyon1.fr/members/lobry/repro/bioinfo04/}.\cr
@@ -86,7 +86,7 @@
\emph{DNA Research}, \bold{15}:357-365. \url{http://dnaresearch.oxfordjournals.org/cgi/reprint/15/6/357}.
}
-\author{ D. Charif, J.R. Lobry, G. Perriere }
+\author{D. Charif, J.R. Lobry, G. Perrière}
\examples{
## Show all possible codons:
Modified: pkg/man/ucoweight.Rd
===================================================================
--- pkg/man/ucoweight.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/ucoweight.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -19,7 +19,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ Leonor Palmeira }
+\author{L. Palmeira}
\seealso{ \code{\link{synsequence}} }
\examples{
data(ec999)
Modified: pkg/man/words.Rd
===================================================================
--- pkg/man/words.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/words.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -17,7 +17,7 @@
\value{
A vector of string whith \code{length} characters.
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\references{
\code{citation("seqinr")}
}
Modified: pkg/man/words.pos.Rd
===================================================================
--- pkg/man/words.pos.Rd 2016-06-03 15:59:03 UTC (rev 1928)
+++ pkg/man/words.pos.Rd 2016-06-03 16:25:25 UTC (rev 1929)
@@ -32,7 +32,7 @@
\references{
\code{citation("seqinr")}
}
-\author{ J.R. Lobry }
+\author{J.R. Lobry}
\seealso{ \code{\link{regexpr}} }
\examples{
myseq <- "tatagaga"
Modified: pkg/man/write.fasta.Rd
[TRUNCATED]
To get the complete diff run:
svnlook diff /svnroot/seqinr -r 1929
More information about the Seqinr-commits
mailing list