[Seqinr-commits] r1957 - in pkg: R man

[noreply at r-forge.r-project.org]

Author: jeanlobry
Date: 2016-06-21 14:40:42 +0200 (Tue, 21 Jun 2016)
New Revision: 1957

Modified:
   pkg/R/gb2fasta.R
   pkg/man/gb2fasta.Rd
Log:
gb2fasta now uses a local file example

Modified: pkg/R/gb2fasta.R
===================================================================
--- pkg/R/gb2fasta.R	2016-06-21 12:26:42 UTC (rev 1956)
+++ pkg/R/gb2fasta.R	2016-06-21 12:40:42 UTC (rev 1957)
@@ -5,8 +5,7 @@
 #                   single entry genbank to fasta conversion
 #
 ########################################################################
-gb2fasta <- function(source.file = "ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Acinetobacter_ADP1_uid61597/NC_005966.gbk",
- destination.file = "Acinetobacter_ADP1_uid61597.fasta")
+gb2fasta <- function(source.file, destination.file)
 {
   input <- readLines(source.file)
   head <- input[1]
@@ -21,10 +20,10 @@
   #
   # Look for sequence position:
   #
-  debut <- which(substring(input,1,6)=="ORIGIN") + 1
+  debut <- which(substring(input,1,6) == "ORIGIN") + 1
   if( length( debut ) > 1 )
     stop("Multiple entries not yet implemented !")
-  fin <- which(substring(input,1,2)=="//") - 1
+  fin <- which(substring(input,1,2) == "//") - 1
   if( length( fin ) > 1 )
     stop("Multiple entries not yet implemented !")
     

Modified: pkg/man/gb2fasta.Rd
===================================================================
--- pkg/man/gb2fasta.Rd	2016-06-21 12:26:42 UTC (rev 1956)
+++ pkg/man/gb2fasta.Rd	2016-06-21 12:40:42 UTC (rev 1957)
@@ -1,13 +1,11 @@
 \name{gb2fasta}
 \alias{gb2fasta}
-\title{ conversion of GenBank file into fasta file }
+\title{Conversion of GenBank file into fasta file}
 \description{
 Converts a single entry in GenBank format into a fasta file.
 }
 \usage{
-gb2fasta(source.file =
-"ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Acinetobacter_ADP1_uid61597/NC_005966.gbk",
-destination.file = "Acinetobacter_ADP1_uid61597.fasta")
+gb2fasta(source.file, destination.file)
 }
 \arguments{
   \item{source.file}{ GenBank file }
@@ -25,6 +23,18 @@
 \author{J.R. Lobry}
 \seealso{ \code{\link{oriloc}} }
 \examples{
-\dontrun{gb2fasta()} # need internet connection
+  myGenBankFile <- system.file("sequences/ct.gbk.gz", package = "seqinr")
+  myFastaFileName <- "Acinetobacter_ADP1_uid61597.fasta"
+  gb2fasta(myGenBankFile, myFastaFileName)
+  readLines(myFastaFileName)[1:5]
+  #
+  # Should be :
+  #
+  # [1] ">CHLTCG 1042519 bp"                                          
+  # [2] "gcggccgcccgggaaattgctaaaagatgggagcaaagagttagagatctacaagataaa"
+  # [3] "ggtgctgcacgaaaattattaaatgatcctttaggccgacgaacacctaattatcagagc"
+  # [4] "aaaaatccaggtgagtatactgtagggaattccatgttttacgatggtcctcaggtagcg"
+  # [5] "aatctccagaacgtcgacactggtttttggctggacatgagcaatctctcagacgttgta"
+  #
 }
 \keyword{utilities}